View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10285_low_14 (Length: 251)

Name: NF10285_low_14
Description: NF10285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10285_low_14
NF10285_low_14
[»] chr8 (1 HSPs)
chr8 (35-239)||(43329262-43329462)


Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 35 - 239
Target Start/End: Complemental strand, 43329462 - 43329262
Alignment:
35 atgaatataaacaactagctagctaggattatgaattggaccttggaaacaacaaggaaatgatcttaaccacatgcggggacgaacttcaaaattcaac 134  Q
    ||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
43329462 atgaatataaacaactagctag----gattatgaattggaccttggaaacaacaaggaaatgatcttaaccacatgcggggaggaacttcaaaattcaac 43329367  T
135 actagcttgccttggatatagaccttattattataaaaatgttattaagtgcataaggtggcactatatatcaatgtgattggttctcctttattgtctc 234  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43329366 actagcttgccttggatatagaccttattattataaaaatgttattaagtgcataaggtggcactatatatcaatgtgattggttctcctttattgtctc 43329267  T
235 tgctc 239  Q
    |||||    
43329266 tgctc 43329262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University