View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10285_low_8 (Length: 282)
Name: NF10285_low_8
Description: NF10285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10285_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 5697512 - 5697244
Alignment:
| Q |
1 |
agagaaattatggattgctcttgataaacaattgaggataatttattggttaatttttgtaactctcttgttcttgatataaaaggttagggtggaaatt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5697512 |
agagaaattatggattgctcttggtaaacaattgaggataatttattggttaatttttgtaactctcttgttcttgatataaaaggttagggtggaaatt |
5697413 |
T |
|
| Q |
101 |
agggtttgcttatgttgatctcatttatggatccgataattgctctctccgtaggcaatttgggttgaactgcgaaaacaatttttgtctgttttttcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5697412 |
agggtttgcttatgttgatctcatttatggatccgataattgctctctccgtaggcaatttgggttgaactgcgaaaacaatctttgtctgttttttcct |
5697313 |
T |
|
| Q |
201 |
tctactctatttatcttctctattctttgaattgcttctttggatttacatcacacataggttctaaat |
269 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5697312 |
tctactctatttatcctctctattctttgaattgcttctttggatttacatcacacataggttctaaat |
5697244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University