View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10286_high_3 (Length: 227)
Name: NF10286_high_3
Description: NF10286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10286_high_3 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
| [»] scaffold0916 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 36494266 - 36494493
Alignment:
| Q |
1 |
tgattcttattcaaccgagttgaatttagcaacatgtcaattacacatgggagctgagatgacttgcctttt-ttccactaatgttagcctcactctcac |
99 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||| ||||| || | ||||| |||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
36494266 |
tgattcttattcaaccgagttgaagttagcaatatgtcgattacgcacgagagcttagatgacttgcctttttttccactgatgttagcctcactctcac |
36494365 |
T |
 |
| Q |
100 |
ttttacttatagataagctaacaaagtcgttcattcataacctaaccataacgtctgtgtttcggactatagtatattctactctcctatccattgctat |
199 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36494366 |
ttttacttatagataggctaacaaagtcgttcattcataacctaaccataacgtctgtgtttcggactatagtatattctactctcctatccattgctat |
36494465 |
T |
 |
| Q |
200 |
tatatctttgagaaatgatatttgaaca |
227 |
Q |
| |
|
||||||||||| |||||||||||||||| |
|
|
| T |
36494466 |
tatatctttgataaatgatatttgaaca |
36494493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0916 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: scaffold0916
Description:
Target: scaffold0916; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 2912 - 2866
Alignment:
| Q |
1 |
tgattcttattcaaccgagttgaatttagcaacatgtcaattacaca |
47 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
2912 |
tgattcttattcaaccgagttgaagttagcaacatgtcgattacaca |
2866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0916; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 3012 - 2976
Alignment:
| Q |
1 |
tgattcttattcaaccgagttgaatttagcaacatgt |
37 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3012 |
tgattcttattcaaccgagttgaagttagcaacatgt |
2976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 47
Target Start/End: Complemental strand, 21950927 - 21950885
Alignment:
| Q |
5 |
tcttattcaaccgagttgaatttagcaacatgtcaattacaca |
47 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||| |||||||| |
|
|
| T |
21950927 |
tcttattcaaccgagttggagttagcaacatgtcgattacaca |
21950885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University