View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10286_low_4 (Length: 206)
Name: NF10286_low_4
Description: NF10286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10286_low_4 |
 | |
|
| [»] scaffold0191 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 17 - 183
Target Start/End: Complemental strand, 37570884 - 37570718
Alignment:
| Q |
17 |
cagagacagagatattggaaattcgaggctttttaaaggaagaaacagttgcatgtaatcctattctccttttcccactagcaggctgcttatgatttgt |
116 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37570884 |
cagaggcagagatattggaaattcgaggctttttaaaggaagaaacagttgcatgtaatcctattctccttttcccactagcaggctgcttatgatttgt |
37570785 |
T |
|
| Q |
117 |
atgaactgtcttaatggtattggaaatatccaccaatgccctgcccaatggtttttcacgtgaatcc |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37570784 |
atgaactgtcttaatggtattggaaatatccaccaatgccctgcccaatggtttttcacgtgaatcc |
37570718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0191 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0191
Description:
Target: scaffold0191; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 31 - 101
Target Start/End: Original strand, 29348 - 29418
Alignment:
| Q |
31 |
ttggaaattcgaggctttttaaaggaagaaacagttgcatgtaatcctattctccttttcccactagcagg |
101 |
Q |
| |
|
|||||||| ||||||||||| || ||||||||| ||||| |||||||| ||||||||||||| ||||||| |
|
|
| T |
29348 |
ttggaaatgcgaggctttttgaaagaagaaacatttgcagttaatcctagtctccttttcccaatagcagg |
29418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 31 - 93
Target Start/End: Complemental strand, 10432952 - 10432890
Alignment:
| Q |
31 |
ttggaaattcgaggctttttaaaggaagaaacagttgcatgtaatcctattctccttttccca |
93 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||| ||||| |||||||| ||||||||||||| |
|
|
| T |
10432952 |
ttggaaatgcgaggctttttgaaggaagaaacatttgcagttaatcctagtctccttttccca |
10432890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University