View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10287_high_7 (Length: 211)
Name: NF10287_high_7
Description: NF10287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10287_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 8 - 194
Target Start/End: Complemental strand, 54703267 - 54703081
Alignment:
| Q |
8 |
gagagagaagaagataacaccaagaaattacgtggttcaaccttagagacctattccgcggaagagagtgtgaagaccaatttcactatgatgaggaaca |
107 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
54703267 |
gagacagaagaagataacaccaagaatttacgtggttcaaccttagagacctattccgcggaagagagtgtgcagaccaatttcactatgatgaggaaca |
54703168 |
T |
|
| Q |
108 |
ataaaacatcagatccatgccatagagtttcccattgccccttgcaatacctactgttgaggacaactacaaaaatgcccaagcttt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54703167 |
ataaaacatcagatccatgccatagagtttcccattgccccttgcaatacctactgttgaggacaactacaaaaatgcccaagcttt |
54703081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 85 - 179
Target Start/End: Original strand, 42310788 - 42310883
Alignment:
| Q |
85 |
caatttcactatgatgaggaacaataaaacatcagatccatgccataga-gtttcccattgccccttgcaatacctactgttgaggacaactacaa |
179 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||| ||| |||||||| |||||| | ||||||||||||||| ||||||||| ||| |||||| |
|
|
| T |
42310788 |
caatttcaccatgatgaggaacaatataacatcaatcccaggccatagacttttcccttggccccttgcaatacccactgttgagaacagctacaa |
42310883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University