View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10287_low_12 (Length: 206)
Name: NF10287_low_12
Description: NF10287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10287_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 29 - 189
Target Start/End: Complemental strand, 36204289 - 36204132
Alignment:
| Q |
29 |
cacagtccaagggttttgaaggaaaccaaaaagctggacattaaacaaggaaaaacaagtacctcatgactaaaatatgattcaggaagaaaagaaagat |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36204289 |
cacagtccaagggttttgaaggaaaccacaaagctggacattaaacaaggaaaaacaagtacctcatgactaaaatatgattcaggaggaaaagaaagat |
36204190 |
T |
 |
| Q |
129 |
tctctccttctttggtagaagtagaaccaagctcattcttggaagcattggggtcacaact |
189 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36204189 |
tctctc---ctttggtagaagtagaaccaagctcattcttggaagcattggggtcccaact |
36204132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University