View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10287_low_4 (Length: 265)
Name: NF10287_low_4
Description: NF10287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10287_low_4 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 115 - 265
Target Start/End: Original strand, 32124513 - 32124668
Alignment:
| Q |
115 |
agttgaaataaacagagagggaaaagagagacctgacgagcttcatggcggcgatggggcggaagatgagcaccggctctcgacttcaacaaccac---- |
210 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32124513 |
agttgagataaacagagagggaaaagagagacctgacgagcttcatggcggcgatggggcggaagatgagcaccggctctcgacttcaacaaccacgaag |
32124612 |
T |
|
| Q |
211 |
-gaagggaggggcgggtcagtgacgctagtcgctcttgcacaagtgttttgttttt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32124613 |
ggaagggaggggcgggtcagtgacgctagtcgctcttgcacaagtgttttgttttt |
32124668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University