View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10288_high_5 (Length: 239)
Name: NF10288_high_5
Description: NF10288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10288_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 33114818 - 33114596
Alignment:
| Q |
1 |
aaaaaatacatggaagttaaagattgagttggcaaaaacaagaaattggttgaagatgtctttggtgctttttagggatagggttaatgcgcaaaagcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33114818 |
aaaaaatacatggaagttaaagattgagttggcaaaaacaagaaattggttgaagatgtctttggtgctttttagggatagggttaatgcgcaaaagcaa |
33114719 |
T |
 |
| Q |
101 |
atcaatttggagtggattttatttgaaataagcaatgaaattttgttgaattagtttggtaatttgtaatctagtttgattatgatgaatctttgtaatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33114718 |
atcaatttggagtggattttatttgaaataagcaatggaattttgctgaattagtttggtaatttgtaatctagtttgattatgatgaatctttgtaatg |
33114619 |
T |
 |
| Q |
201 |
gtttgaaccaatgtactactatt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33114618 |
gtttgaaccaatgtactactatt |
33114596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University