View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10288_low_13 (Length: 237)
Name: NF10288_low_13
Description: NF10288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10288_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 21 - 224
Target Start/End: Original strand, 2231058 - 2231261
Alignment:
| Q |
21 |
ccagaacatagataaaaattgaagtttgatccaacatttgatgttctgaacataaagaactactttcacaagccataattactaatttgacacgagataa |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2231058 |
ccagaacatagataaaaattgaagtttgatccaacatttgatgttctaaacataaagaactaatttgacaagccataattactaatttgacacgagataa |
2231157 |
T |
|
| Q |
121 |
atataaaggaactctttgaaatttaaaatcgaggtaaaatatttcttgagtagtttggcctttattacattagttcagagaaaacatcataatatgaaaa |
220 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
2231158 |
atataaaggaactctgtgaaatttaaaatcgaggtaaaatatttcttgagtagtttggcctttattacattagttcagagaaaacatctttatatgaaaa |
2231257 |
T |
|
| Q |
221 |
aatt |
224 |
Q |
| |
|
|||| |
|
|
| T |
2231258 |
aatt |
2231261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University