View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10288_low_14 (Length: 237)
Name: NF10288_low_14
Description: NF10288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10288_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 163
Target Start/End: Original strand, 52407021 - 52407183
Alignment:
| Q |
1 |
gacatgacacttttgctttggttagggaatcaaccatggctgaccccaccaaggctaagctcctccacaatttcaagactataggtgttaatttggtcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52407021 |
gacatgacacttttgctttggttagggaatcaaccatggctgaccccaccaaggctaagctcctccacaatttcaagactataggtgttaatttggtcca |
52407120 |
T |
|
| Q |
101 |
tgtaagatttcaaacaccatctcttaatttaccttacattatatcatgaacatccaggcatat |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52407121 |
tgtaagatttcaaacaccatctcttaatttaccttacattatatcatgaacatccaggcatat |
52407183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 164 - 224
Target Start/End: Original strand, 52407208 - 52407268
Alignment:
| Q |
164 |
aatggcattggcagggggatctctacgataatgagagcttggtgaaagcaatgaagcaggt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52407208 |
aatggcattggcagggggatctctacgataatgagagcttggtgaaagcaatgaagcaggt |
52407268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University