View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10289_high_10 (Length: 261)

Name: NF10289_high_10
Description: NF10289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10289_high_10
NF10289_high_10
[»] chr3 (1 HSPs)
chr3 (18-224)||(4403159-4403365)


Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 224
Target Start/End: Original strand, 4403159 - 4403365
Alignment:
18 ggttgtcgttgggtttacaaaatcaaacatcatgttgatggcactattgaacgttaaaagacacgacttgttgccaaaggatttactcaattagaccgga 117  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4403159 ggttgtcgttgggtttagaaaatcaaacatcatgttgatggcactattgaacgttaaaagacacgacttgttgccaaaggatttactcaattagaccgga 4403258  T
118 tggactattttgagacctttagtccggttggtcaactcactactgttagagttctcttggcattggcagctgcaaaaggttggtttttagagcatttaga 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4403259 tggactattttgagacctttagtccggttggtcaactcactactgttagagttctcttggcattggcagctgcaaaaggttggtttttagagcatttaga 4403358  T
218 tgtcaat 224  Q
    |||||||    
4403359 tgtcaat 4403365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University