View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10289_high_10 (Length: 261)
Name: NF10289_high_10
Description: NF10289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10289_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 224
Target Start/End: Original strand, 4403159 - 4403365
Alignment:
| Q |
18 |
ggttgtcgttgggtttacaaaatcaaacatcatgttgatggcactattgaacgttaaaagacacgacttgttgccaaaggatttactcaattagaccgga |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4403159 |
ggttgtcgttgggtttagaaaatcaaacatcatgttgatggcactattgaacgttaaaagacacgacttgttgccaaaggatttactcaattagaccgga |
4403258 |
T |
 |
| Q |
118 |
tggactattttgagacctttagtccggttggtcaactcactactgttagagttctcttggcattggcagctgcaaaaggttggtttttagagcatttaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4403259 |
tggactattttgagacctttagtccggttggtcaactcactactgttagagttctcttggcattggcagctgcaaaaggttggtttttagagcatttaga |
4403358 |
T |
 |
| Q |
218 |
tgtcaat |
224 |
Q |
| |
|
||||||| |
|
|
| T |
4403359 |
tgtcaat |
4403365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University