View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10289_high_11 (Length: 252)

Name: NF10289_high_11
Description: NF10289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10289_high_11
NF10289_high_11
[»] chr1 (1 HSPs)
chr1 (1-244)||(2323031-2323275)


Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 2323031 - 2323275
Alignment:
1 accaatgacggagaaattgggatttttggcttttccccgggctttgatgagaggttcttcttaactgtatcataagcaaatagctgcagaaaagaaagnn 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      
2323031 accaatgacggagaaattgggatttttggcttttccccgggctttgatgagaggttcttcttaactgtatcataagcaaatagctgcagaaaagaaagaa 2323130  T
101 nnnnnn-cagcaatatattcagatgcatnnnnnnnntgctggagttaaatctatgatcatggggattattaaattactaatagaagacaaaacaaaatgt 199  Q
           |||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2323131 aaaaaaacagcaatatattcagatgcataaaaaaaatgctggagttaaatctatgatcatggggattattaaattactaatagaagacaaaacaaaatgt 2323230  T
200 ctaaaaacagttaaaatactaccacatacaaccagacttcatctc 244  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
2323231 ctaaaaacagttaaaatactaccacatacaaccagacttcatctc 2323275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University