View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10289_high_12 (Length: 250)

Name: NF10289_high_12
Description: NF10289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10289_high_12
NF10289_high_12
[»] chr8 (1 HSPs)
chr8 (1-244)||(2449553-2449796)


Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 2449796 - 2449553
Alignment:
1 ttttggaaccacacaactgcaagggtaacgagggatgcataaattgcattgggtaacttctgcaccacttttccaacgccagggacaccttcagtggctc 100  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||    
2449796 ttttggaaccacacaactgcaagggtaacaagggatgcataaattgcattcggtaacttctgcaccacttttccaacaccagggacaccttcagtggctc 2449697  T
101 tttttgttgccattgcaacactcggtgctacgaccaaagtgatgataagtttctgactaacaacagtgaatgtatcagctgtcattttctggatgaaatc 200  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2449696 tttttgttgccattgcaacacttggtgctacgaccaaagtgatgataagtttctgactaacaacagtgaatgtatcagctgtcattttctggatgaaatc 2449597  T
201 gcaaaattcgtcatgatcaattgccccatccaagttcatctcac 244  Q
    ||||||||||||||||||||||||||||||||||||||| ||||    
2449596 gcaaaattcgtcatgatcaattgccccatccaagttcatatcac 2449553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University