View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10289_high_15 (Length: 247)

Name: NF10289_high_15
Description: NF10289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10289_high_15
NF10289_high_15
[»] chr1 (1 HSPs)
chr1 (1-232)||(26582302-26582531)


Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 26582531 - 26582302
Alignment:
1 tattgatttagtaaagtttatatgtctaacttcatataagttaaaagttgagcatgaataattgatttagcaaaggtatcacatttgtagtaagttcaca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
26582531 tattgatttagtaaagtttatatgtctaacttcatataagttaaaagttgatcatgaataattgatttagcaaaggtatcacatttgtagtaagttcaca 26582432  T
101 ctaatgttttatgcatgttgtagtnnnnnnngcatgataataattttcaagtagttgtccaatgattggattattgatggtcgatttaacatatatacta 200  Q
    ||||||||||||||||||||||||         ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
26582431 ctaatgttttatgcatgttgtagtaaaaaaa--atgataataattttcgagtagttgtccaatgattggattattgatggtcgatttaacatatatacta 26582334  T
201 aattatattgtcatcgcgttgtaatatttata 232  Q
    |||||||||||||||| |||||||||||||||    
26582333 aattatattgtcatcgtgttgtaatatttata 26582302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University