View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10289_high_20 (Length: 213)

Name: NF10289_high_20
Description: NF10289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10289_high_20
NF10289_high_20
[»] chr7 (1 HSPs)
chr7 (41-120)||(48865352-48865431)


Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 41 - 120
Target Start/End: Original strand, 48865352 - 48865431
Alignment:
41 taccaaagccagcgatgagacaagaagcagcgacaactggttcttgagcaacgaacattctgagcctctccatcacagcc 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48865352 taccaaagccagcgatgagacaagaagcagcgacaactggttcttgagcaacgaacattctgagcctctccatcacagcc 48865431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University