View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10289_low_24 (Length: 229)
Name: NF10289_low_24
Description: NF10289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10289_low_24 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 2450113 - 2449891
Alignment:
| Q |
7 |
actatcgcatgcatagcatagcctttgacagcaaagtcgagagtaaatctgttagcactttctgcgccttgattctttcattggccctggcgagtcccca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||| ||||| ||||||| || ||||||||||||||||||||||||| ||||||| |
|
|
| T |
2450113 |
actatcgcatgcatagcatagcctttgacagtaaagtcaagagtatctctgtcggcactttatgtgccttgattctttcattggccctggtgagtccctt |
2450014 |
T |
 |
| Q |
107 |
taacccaacttgcctaaatttttatttaccataaaacaatggtcaagagtatattttttgttcaaaatgccaaatacacccattcttatttaggatagca |
206 |
Q |
| |
|
||||||| || ||||||||||||||||| |||||||||| ||||||||| | |||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
2450013 |
taacccagctcgcctaaatttttatttatcataaaacaaaggtcaagagcagattttttgttcaaaatgccaaatacaaccattcttatttaggacagca |
2449914 |
T |
 |
| Q |
207 |
attctaacatgaaaacagtggca |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2449913 |
attctaacatgaaaacagtggca |
2449891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University