View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10289_low_26 (Length: 224)
Name: NF10289_low_26
Description: NF10289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10289_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 4553799 - 4553605
Alignment:
| Q |
18 |
acatcaacaacggatcgaaccctattctttgtgggatcgtaaggattacaacttgattgtaccatgtgtttggggagtacacacattcacttaagttaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4553799 |
acatcaacaacggatcgaaccctattctttgtgggatcataaggattacaacttgattgtaccatgtgtttggggagtacacacattcacttaagttaaa |
4553700 |
T |
 |
| Q |
118 |
agagaaactctaacactaaagcctatccataatctagtgaccaagtaccaaattggcacc-----atcaacatataaaacatccccgtgagctta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
4553699 |
agagaaactctaacactaaagcctatccataatccagtgaccaagtaccaaattggcaccattaaatcaacatatataacatccccgtgagctta |
4553605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University