View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10289_low_7 (Length: 401)
Name: NF10289_low_7
Description: NF10289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10289_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 20 - 391
Target Start/End: Original strand, 42745531 - 42745902
Alignment:
| Q |
20 |
gtttgcttatggactctgatcccaactttgcacagagatcctgaaatttggggaccagattccaacgagtttaaacccgaaaggttcagtgagggtgtgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42745531 |
gtttgcttatggactctgatcccaactttgcacagagatcctgaaatttggggaccagattccaacgagtttaaacccgaaaggttcagtgagggtgtgt |
42745630 |
T |
|
| Q |
120 |
cgaaggctatcaagtttccacaagcgtatgtgccatttggaatcggcactcggttgtgcgtggggaagaactttgcaatggttgaactaaaggttgtgct |
219 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42745631 |
ctaaggctatcaagtttccacaagcgtatgtgccatttggaatcggcactcggttgtgcgtggggaagaactttgcaatggttgaactaaaggttgtgct |
42745730 |
T |
|
| Q |
220 |
agcccttattgtctccaagttcagcttctctttgtctcctagttataagcattctcctgcatataatatgattgtagagccaggacatggtgtgtatctt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42745731 |
agcccttattgtctccaagttcagcttctctttgtctcctagttataagcattctcctgcatataatatgattgtagagccaggacatggtgtgtatctt |
42745830 |
T |
|
| Q |
320 |
ctcattcagaagaactgatgaaaccaattcatcaactttaatgcacaagcatttgatttcttctggcctatg |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42745831 |
ctcattcagaagaactgatgaaaccaattcatcaactttaatgcacaatcatttgatttcttctggcctatg |
42745902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University