View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10289_low_8 (Length: 383)
Name: NF10289_low_8
Description: NF10289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10289_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 326
Target Start/End: Original strand, 44150666 - 44150960
Alignment:
| Q |
1 |
tcttttatagctttttggcaagacaaggtaccattgatcttgttctctctccacaccatgtctatggaaactttggctaaccataaacccttgttgtttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44150666 |
tcttttatagctttttggcaagacaaggtaccattgatcatgttctctctcca-accatgtctatggaaactttggctaaccataaacccttgttgtttg |
44150764 |
T |
 |
| Q |
101 |
tcaaggatatgtcaatgtgaatccgtgagactgagagccaaatttcagtattatgatactttaaaatgccatataataagaaagggtccactatgccatc |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44150765 |
tcaaggatatgtcaatatgaatccgtgagactgagagccaaatttcagtattatgatactttaaaatgccatataataagaaagggtccactatgccatc |
44150864 |
T |
 |
| Q |
201 |
aattgcctctccttagggaagaacacggggatgagacttttgagttatgcttgccccttattatacaatggcagactattgtaggggcaatccctttctc |
300 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44150865 |
aattgcctctccttagggaa------------gagacttttgagttatgcttgcccct------------------tattgtaggggcaatccctttctc |
44150934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University