View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1028_high_3 (Length: 231)

Name: NF1028_high_3
Description: NF1028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1028_high_3
NF1028_high_3
[»] chr4 (1 HSPs)
chr4 (11-107)||(44830492-44830588)
[»] chr1 (1 HSPs)
chr1 (195-231)||(26335856-26335892)


Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 11 - 107
Target Start/End: Original strand, 44830492 - 44830588
Alignment:
11 ttgagactaacaataggcatacattccaatattttgataaaagtgcatatcaaatctggtaattgggattgaccatccatacttttctagactctct 107  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44830492 ttgagactaacaataggtatacattccaatattttgataaaagtgcatatcaaatctggtaattgggattgaccatccatacttttctagactctct 44830588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 195 - 231
Target Start/End: Complemental strand, 26335892 - 26335856
Alignment:
195 ttggtgatctccatccccaatactttgctgcacaaca 231  Q
    ||||||||||| ||||| |||||||||||||||||||    
26335892 ttggtgatctcaatcccaaatactttgctgcacaaca 26335856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University