View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1028_low_11 (Length: 214)
Name: NF1028_low_11
Description: NF1028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1028_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 1672927 - 1672749
Alignment:
| Q |
1 |
aatagcctttttaattcctccccatcatcatcgtagaaggaagtcccaaatattttcttagacccgattgctagcttcttgataagtctcaagaatgtga |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1672927 |
aatagccttttttattcctccccatcatc---gtagaaggaagtcccaaatattttcttagacccgattgctagcttcttgataagtctcaagaatgtga |
1672831 |
T |
|
| Q |
101 |
tttatcgtgcaaaagctattgcaattttgagcaaacatgaaaaaagttggacgtgtaaccaaataattgtaaatatcatttt |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1672830 |
tttatcgtgcaaaagctattgcaattttgagcaaacatgaaaaaagttggacgtgtaacgaaataattgtaaatatcatttt |
1672749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 178 - 214
Target Start/End: Complemental strand, 1672605 - 1672569
Alignment:
| Q |
178 |
attttatattatcataaaataataaaattgacttata |
214 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1672605 |
attttgtattatcataaaataataaaattgacttata |
1672569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University