View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1028_low_6 (Length: 291)
Name: NF1028_low_6
Description: NF1028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1028_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 70 - 230
Target Start/End: Original strand, 42341796 - 42341956
Alignment:
| Q |
70 |
gatatgaatggtttacgaggaagaaagaggatggttgatggtcctgttgaaagggtggtggagagaaggcagaggaggatgatcaagaatagagagtcag |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42341796 |
gatatgaatggtttacgaggaagaaagaggatggttgatggtcctgttgaaagggtggtggagagaaggcagaggaggatgatcaagaatagagagtcag |
42341895 |
T |
|
| Q |
170 |
cagcaagatctagagccagaaaacaggttcctgaaattttaaccaatcatattatacttaa |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42341896 |
cagcaagatctagagccagaaaacaggttcctgaaattttaaccaatcatattatacttaa |
42341956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University