View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1029-Insertion-5 (Length: 343)
Name: NF1029-Insertion-5
Description: NF1029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1029-Insertion-5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 8 - 315
Target Start/End: Original strand, 30601319 - 30601622
Alignment:
| Q |
8 |
atttatttcagaatcgtggaagaacggtccataatgctagtctgttctatacttttgaattttaatgactcactaattttatttctgaaggaacaagagc |
107 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| || | || | |||| |||||||||||||||||||| |
|
|
| T |
30601319 |
atttatttcagaatcgtggaagaatggtccataatgctagtctgttctacacttttgaag---aacggtccagttattt-atttctgaaggaacaagagc |
30601414 |
T |
|
| Q |
108 |
atcgtgcaaggttgaatatctaatctagctttgaacttgtacatatcattgaattatttcaggctaatattgggtatgtcattttgaactatttgatcat |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30601415 |
atcgtgcaaggttgaatatctagtctagctttgaacttgtacatatcattgaattatttcaggctaatattgggtatgtcattttgaactatttgatcat |
30601514 |
T |
|
| Q |
208 |
tgatttttcaagctctcggatactataaaatcataaatcaagttatgcaaatatatgtgctttgaagtcttcccttcatttgttaaaaccacgtttatga |
307 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||| ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30601515 |
tgatttttcaagctctcagatactataaaattataaatcaaattatgcaaatatatgtgcttttaagtcttcccctcatttgttaaaaccacgtttatga |
30601614 |
T |
|
| Q |
308 |
taacactt |
315 |
Q |
| |
|
|||||||| |
|
|
| T |
30601615 |
taacactt |
30601622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University