View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10290_high_20 (Length: 300)
Name: NF10290_high_20
Description: NF10290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10290_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 282
Target Start/End: Complemental strand, 32604779 - 32604516
Alignment:
| Q |
18 |
cagagacgcgtgccgtcgtttaatttgtcttgggaatttacnnnnnnngaaaatgttggtttcaacccatgtcaaatctcgtcacacattttgctaacat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32604779 |
cagagacgcgtgccgtcgtttaatttgtcttgggaatttactttttttgaaa-tgttggtttcaacccatgtcaaatctcgtcgcacattttgctaacat |
32604681 |
T |
 |
| Q |
118 |
cattgtacgttcgaccttccattttctatcgtatgtgcaatctgagccatcttgttttttactcttattgttttcaacactatgaatagaaatctaaggc |
217 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32604680 |
cattgtgcgttcgaccttccattttctatggtatgtgcaacctgagccatcttgttttttactcttattgttttcaacactatgaatagaaatctaaggc |
32604581 |
T |
 |
| Q |
218 |
tccatcccaaatcacatgaaagcttccaagctttctcttttctctcttttgctcgttgcacttct |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32604580 |
tccatcccaaatcacatgaaagcttccaagctttctcttttctctcttttgctcgttgcacttct |
32604516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University