View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10290_high_29 (Length: 222)
Name: NF10290_high_29
Description: NF10290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10290_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 8716947 - 8716736
Alignment:
| Q |
1 |
tacgtttccaaccaaatacaccaaacagttgttagaaaaattagatgagacgcttttttacccttctttcctttacaaagcgaaataaacagcatgaagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8716947 |
tacgtttccaaccaaatacaccaaacagttgttagaaaatttagatgagacgcttttttaccattctttcctttacaaagcgaaataaacagcatgaagt |
8716848 |
T |
 |
| Q |
101 |
tatcaattaatgcattgctccattccactgctttccaatctagccatctaaaaattaactcccatattttgagtctttctgcaattcacgaacaaatgac |
200 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8716847 |
tatcaattaatgcatttctccattcgactgctttccaatctagccatctaaaaattaaatcccatattttgagtctttctgcaattcacgaacaaatgac |
8716748 |
T |
 |
| Q |
201 |
ttgctgtctctg |
212 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
8716747 |
ttactgtctctg |
8716736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University