View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10290_low_16 (Length: 333)
Name: NF10290_low_16
Description: NF10290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10290_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 323
Target Start/End: Complemental strand, 32956617 - 32956295
Alignment:
| Q |
1 |
ccttactcatacactactccatcatcttcttcttcctcttctgttgattgcacactctcccttgctaccccttccacacgtttatctgaagaccaagata |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32956617 |
ccttactcatacactactccatcttcttcttcttcttcttctgttgattgcacactctcccttgctaccccttccacacgtttatctgaagaccaagata |
32956518 |
T |
 |
| Q |
101 |
aacgaaaccgtcgctcttctcttgctaattttttctgtaccaaatcttcaaacactaaacataattctcaatctcaatccaagtcaaacaatattggtag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32956517 |
aacgaaaccgtcgctcttctcttgctaattttttctgtaccaaatcttcaaacactaaacataattctcaatctcaatccaagtcaaacaatattggtag |
32956418 |
T |
 |
| Q |
201 |
taactctaacaatgattctcttcttgctcgtcgatgtgctagctgtgactccacttctacacccctttggaggaatggtcctcgtggccctaaggtaaaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32956417 |
taactctaacaatgattctcttcttgctcgtcgttgtgctagctgtgactccacttctacacccctttggaggaatggtcctcgtggccctaaggtaaaa |
32956318 |
T |
 |
| Q |
301 |
atacattaccaataccacctttg |
323 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
32956317 |
atacattaccaataccatctttg |
32956295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 208 - 301
Target Start/End: Original strand, 7723517 - 7723610
Alignment:
| Q |
208 |
aacaatgattctcttcttgctcgtcgatgtgctagctgtgactccacttctacacccctttggaggaatggtcctcgtggccctaaggtaaaaa |
301 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| | ||||||| |||| || ||||| ||||||||||| || ||||| ||||| |||||||||| |
|
|
| T |
7723517 |
aacaatgattctcttcttgctcgtagatgtgcaaactgtgacaccacctccacaccgctttggaggaacggccctcgaggcccaaaggtaaaaa |
7723610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University