View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10290_low_24 (Length: 285)
Name: NF10290_low_24
Description: NF10290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10290_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 279
Target Start/End: Original strand, 42250108 - 42250370
Alignment:
| Q |
18 |
gaatacatacatacacacgcaaaggtgaaggaaaatgcgaaggaatatgcagatagggacgatgaagctgaacaagaatgaagatggatttggatgataa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42250108 |
gaatacatacatacacacgcaaaggtgaaggaaaatgcgaaggaatatgcagatagggacgatgaagctgaacaagaatgaagatggatttggatgataa |
42250207 |
T |
 |
| Q |
118 |
tgatgatgatgttatatatgaagcttttctcgtctatgtgtttttgaccaattagaattatacacgtggtggatccatctttcttttatgaatatccttt |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42250208 |
tgatgatgatgttatatatgaagtttttctcgtctatgtgtttttgaccaattagaattatacacgtggtggatccatctttcttttatgaatatccttt |
42250307 |
T |
 |
| Q |
218 |
ttccaataccaataaattagttggg-aataccgtgaatctatgtcactcaatgttcttctctc |
279 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
42250308 |
ttccaataccaataaattagttgggaaataccgtgaatctatgtcactcaatgtccttttctc |
42250370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University