View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10290_low_26 (Length: 269)
Name: NF10290_low_26
Description: NF10290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10290_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 14 - 253
Target Start/End: Original strand, 25989745 - 25989986
Alignment:
| Q |
14 |
agagagctagagagaaaatgaattattgaatgagtttaggaaaattaaggatattcaaatgtaagtat-gattaaagtattgcaaccgatcaacttgaac |
112 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25989745 |
agagagctagagagaaaatgaattgttgaatgagtttaggaaaattaaggatattcaaatgtaagtattgattaaagtattgcaaccgatcaacttgaac |
25989844 |
T |
 |
| Q |
113 |
ttaaaattttgtgagtgacctttcgaacacagcacaagggaacgataaaagcatatcaaagaaaacgttaaggcaaag-aacaatcaaacaaaacaagta |
211 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
25989845 |
ataaaatttggtgagtgacctttcgaacacagcacaagggaacgataaaagcatatcaaagaaaacgttgaggcaaagaaacaatcaaacaaaacaagta |
25989944 |
T |
 |
| Q |
212 |
tgctagattatcctatcaagaagagcataacattctccaatt |
253 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||| |||||||| |
|
|
| T |
25989945 |
tgctagattatcctatcaaaaagagcatagcatcctccaatt |
25989986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University