View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10290_low_26 (Length: 269)

Name: NF10290_low_26
Description: NF10290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10290_low_26
NF10290_low_26
[»] chr2 (1 HSPs)
chr2 (14-253)||(25989745-25989986)


Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 14 - 253
Target Start/End: Original strand, 25989745 - 25989986
Alignment:
14 agagagctagagagaaaatgaattattgaatgagtttaggaaaattaaggatattcaaatgtaagtat-gattaaagtattgcaaccgatcaacttgaac 112  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
25989745 agagagctagagagaaaatgaattgttgaatgagtttaggaaaattaaggatattcaaatgtaagtattgattaaagtattgcaaccgatcaacttgaac 25989844  T
113 ttaaaattttgtgagtgacctttcgaacacagcacaagggaacgataaaagcatatcaaagaaaacgttaaggcaaag-aacaatcaaacaaaacaagta 211  Q
     |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||    
25989845 ataaaatttggtgagtgacctttcgaacacagcacaagggaacgataaaagcatatcaaagaaaacgttgaggcaaagaaacaatcaaacaaaacaagta 25989944  T
212 tgctagattatcctatcaagaagagcataacattctccaatt 253  Q
    ||||||||||||||||||| ||||||||| ||| ||||||||    
25989945 tgctagattatcctatcaaaaagagcatagcatcctccaatt 25989986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University