View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10290_low_28 (Length: 251)

Name: NF10290_low_28
Description: NF10290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10290_low_28
NF10290_low_28
[»] chr6 (1 HSPs)
chr6 (1-193)||(3018069-3018260)
[»] chr4 (2 HSPs)
chr4 (3-192)||(34344363-34344552)
chr4 (1-58)||(18912932-18912989)
[»] chr7 (2 HSPs)
chr7 (37-192)||(46419943-46420098)
chr7 (123-172)||(41201843-41201892)
[»] chr5 (1 HSPs)
chr5 (1-193)||(37278276-37278468)
[»] chr3 (5 HSPs)
chr3 (123-172)||(23702340-23702389)
chr3 (123-172)||(23720796-23720845)
chr3 (123-172)||(23739252-23739301)
chr3 (123-172)||(18554392-18554441)
chr3 (154-195)||(47165460-47165501)
[»] chr8 (2 HSPs)
chr8 (122-174)||(44462732-44462784)
chr8 (122-174)||(44470263-44470315)


Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 3018069 - 3018260
Alignment:
Q  1 attttcccgcttgcaatttgccaggggttgtttcattttgacagggtcaaacccctgttttacgtgaacagtgtcccactttttctgaagtcattttccc 100  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  3018069 attttcccgcttgcaatttgccaggggttgtttcattttgccagggtcaaacccctgttttacatgaacagtgtcccactttttctgaagtcattttccc 3018168  T
Q  101 agggacgtcccctggctttgctcctggaaaatttgcctggggcttccaggccttgtcaaaatccctggcaaatgaacagatttcttgtagtgt 193  Q
    | ||||||||||||||| ||||||||| |||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  3018169 a-ggacgtcccctggctctgctcctgggaaattttccaggggcttcaaggccttgtcaaaatccctggcaaatgaacagatttcttgtagtgt 3018260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 3 - 192
Target Start/End: Original strand, 34344363 - 34344552
Alignment:
Q  3 tttcccgcttgcaatttgccaggggttgtttcattttgacagggtcaaacccctgttttacgtgaacagtgtcccactttttctgaagtcattttcccag 102  Q
    |||||||||||||||||||| ||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  34344363 tttcccgcttgcaatttgcccggggttgtttcattttgccagggttaaacccctgttttacgtgaacagtgtcccacttttcctgaagtcattttcccag 34344462  T
Q  103 ggacgtcccctggctttgctcctggaaaatttgcctggggcttccaggccttgtcaaaatccctggcaaatgaacagatttcttgtagtg 192  Q
    ||||||||||||||||||||||||| ||||||||| |||| ||| |||||||||||||||||||| ||||||||||||||||||||||||    
T  34344463 ggacgtcccctggctttgctcctgggaaatttgccaggggtttcaaggccttgtcaaaatccctgacaaatgaacagatttcttgtagtg 34344552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 18912989 - 18912932
Alignment:
Q  1 attttcccgcttgcaatttgccaggggttgtttcattttgacagggtcaaacccctgt 58  Q
    ||||||||||||||||||| |||||||||||||| |||||  |||| |||||||||||    
T  18912989 attttcccgcttgcaatttaccaggggttgtttccttttgtgagggacaaacccctgt 18912932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 37 - 192
Target Start/End: Complemental strand, 46420098 - 46419943
Alignment:
Q  37 tttgacagggtcaaacccctgttttacgtgaacagtgtcccactttttctgaagtcattttcccagggacgtcccctggctttgctcctggaaaatttgc 136  Q
    |||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| ||| ||||||||    
T  46420098 tttgccagggtcaaacccctgttttacgtgaacagtgtcccacttttcctgaagtcattttcccagggacgtcccctgactttgctcttgggaaatttgc 46419999  T
Q  137 ctggggcttccaggccttgtcaaaatccctggcaaatgaacagatttcttgtagtg 192  Q
    | |||| ||| |||||||||||||||||||| ||||||||||||||||||||||||    
T  46419998 caggggtttcaaggccttgtcaaaatccctgacaaatgaacagatttcttgtagtg 46419943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 172
Target Start/End: Original strand, 41201843 - 41201892
Alignment:
Q  123 cctggaaaatttgcctggggcttccaggccttgtcaaaatccctggcaaa 172  Q
    ||||||||||||||| |||||||| |  ||||||||||||||||||||||    
T  41201843 cctggaaaatttgccaggggcttcaaacccttgtcaaaatccctggcaaa 41201892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 37278468 - 37278276
Alignment:
Q  1 attttcccgcttgcaatttgccaggggttgtttcattttgacagggtcaaacccctgttttacgtgaacagtgtcccactttttctgaagtcattttccc 100  Q
    ||||||||||||  || |||||| || ||||||| ||||| |||||| ||||||||||||||||||||| ||||| |||||||||||||||| |||||||    
T  37278468 attttcccgcttataaattgccaaggattgtttctttttgccagggttaaacccctgttttacgtgaactgtgtctcactttttctgaagtcgttttccc 37278369  T
Q  101 agggacgtcccctggctttgctcctggaaaatttgcctggggcttccaggccttgtcaaaatccctggcaaatgaacagatttcttgtagtgt 193  Q
    |||| | |||||||||||||||||| ||||||||| | |||| ||| ||||| ||||||||||| ||||||||| ||| ||||||||||||||    
T  37278368 agggtcatcccctggctttgctcctcgaaaatttgtcaggggtttcaaggccctgtcaaaatccttggcaaatggacaaatttcttgtagtgt 37278276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 172
Target Start/End: Complemental strand, 23702389 - 23702340
Alignment:
Q  123 cctggaaaatttgcctggggcttccaggccttgtcaaaatccctggcaaa 172  Q
    ||||||||||||||| |||||||| |  ||||||||||||||||||||||    
T  23702389 cctggaaaatttgccaggggcttcaaacccttgtcaaaatccctggcaaa 23702340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 172
Target Start/End: Complemental strand, 23720845 - 23720796
Alignment:
Q  123 cctggaaaatttgcctggggcttccaggccttgtcaaaatccctggcaaa 172  Q
    ||||||||||||||| |||||||| |  ||||||||||||||||||||||    
T  23720845 cctggaaaatttgccaggggcttcaaacccttgtcaaaatccctggcaaa 23720796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 172
Target Start/End: Complemental strand, 23739301 - 23739252
Alignment:
Q  123 cctggaaaatttgcctggggcttccaggccttgtcaaaatccctggcaaa 172  Q
    ||||||||||||||| |||||||| |  ||||||||||||||||||||||    
T  23739301 cctggaaaatttgccaggggcttcaaacccttgtcaaaatccctggcaaa 23739252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 172
Target Start/End: Original strand, 18554392 - 18554441
Alignment:
Q  123 cctggaaaatttgcctggggcttccaggccttgtcaaaatccctggcaaa 172  Q
    ||||| ||||||||| |||||||| |  ||||||||||||||||||||||    
T  18554392 cctggcaaatttgccaggggcttcaaacccttgtcaaaatccctggcaaa 18554441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 154 - 195
Target Start/End: Complemental strand, 47165501 - 47165460
Alignment:
Q  154 tgtcaaaatccctggcaaatgaacagatttcttgtagtgttg 195  Q
    ||||||||||||| |||||||| || ||||||||||||||||    
T  47165501 tgtcaaaatccctagcaaatgagcatatttcttgtagtgttg 47165460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 44462784 - 44462732
Alignment:
Q  122 tcctggaaaatttgcctggggcttccaggccttgtcaaaatccctggcaaatg 174  Q
    ||||||||||||| || |||| |||  | ||||||||||||||||||||||||    
T  44462784 tcctggaaaatttcccaggggtttcatgtccttgtcaaaatccctggcaaatg 44462732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 44470315 - 44470263
Alignment:
Q  122 tcctggaaaatttgcctggggcttccaggccttgtcaaaatccctggcaaatg 174  Q
    ||||||||||||| || |||| |||  | ||||||||||||||||||||||||    
T  44470315 tcctggaaaatttcccaggggtttcatgtccttgtcaaaatccctggcaaatg 44470263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University