View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10290_low_9 (Length: 455)
Name: NF10290_low_9
Description: NF10290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10290_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 398; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 398; E-Value: 0
Query Start/End: Original strand, 18 - 423
Target Start/End: Complemental strand, 6701586 - 6701181
Alignment:
| Q |
18 |
ttttcttccccggcgagctgtgcatcactccggcacggtgagcctcccggagtttctctcactccctgtcggagaaaaactcagggaaaaactcaaaggc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6701586 |
ttttcttccccggcgagctgtgcatcactccggcacggtgagcctcccggagtttctctcactccctgtcggagaaaaactcagggaaaaactcaaaggc |
6701487 |
T |
 |
| Q |
118 |
attaacaccggtgatcgtttccttgatctcaattatgcaccggcgccggaaaaggcaacatcgccggcgaagttcacggtggaggatgcgaggaagattc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6701486 |
attaacaccggtgatcgtttccttgatctcaattttgcaccggcgccggaaaaggcaacatcgccggcgaagttcacggtggaggatgcgaggaagattc |
6701387 |
T |
 |
| Q |
218 |
tgaaagcatcgcaaatggagaagttgaagaggaaactgagagaggtttcggagaattcagttagttacggtgagtttttgaggatctgtgttgaatcgtg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6701386 |
tgaaagcatcgcaaatggagaagttgaagaggaaactgagagaggtttcggagaattcagttagttacggtgagtttttgaggatctgcgttgaatcgtg |
6701287 |
T |
 |
| Q |
318 |
tgagaatcatgaacaaggtgttgagtttgcaaagatattggatgaatctggaaacgtcatcgttttggggaatgttgtttttctccggccagaacaggta |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6701286 |
tgagaatcatgaacaaggtgttgagtttgcaaagatattggatgaatctggaaacgtcatcgttttggggaatgttgtttttctccggccagaacaggta |
6701187 |
T |
 |
| Q |
418 |
tgtgca |
423 |
Q |
| |
|
|||||| |
|
|
| T |
6701186 |
tgtgca |
6701181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University