View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10291_high_15 (Length: 249)
Name: NF10291_high_15
Description: NF10291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10291_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 45122026 - 45122260
Alignment:
| Q |
1 |
caagagctctattcatttcatcctcagaatgttcattgctgatggcgtgctcagtgtggtgaagtgaagagagcatgtcccaagaagatgaacttgattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45122026 |
caagagctctattcatttcatcctcagaatgttcattgctgatggcgtgctcagtgtggtgaagtgaagagagcatgtcccaagaaaatgaacttgattc |
45122125 |
T |
|
| Q |
101 |
aatgtccaacatttcagctttaccaagcctatcccacaaactaatttcagtttgctcgggaagctgatcaatttttgcatcctctgcagattctctaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45122126 |
aatgtccaacatttcagctttaccaagcctgtcccacaaactaatttcagtttgctcgggaagctgatcaatttttgcatcctctgcagattctctaaga |
45122225 |
T |
|
| Q |
201 |
ctaaaaataatttaaatcagttatcaacaacttta |
235 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45122226 |
ctataaataatttaaatcagttatcaacaacttta |
45122260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 40258119 - 40258266
Alignment:
| Q |
1 |
caagagctctattcatttcatcctcagaatgttcattgctgatggcgtgctcagtgtggtgaagtgaagagagcatgtcccaagaagatgaacttgattc |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||| ||||| || |||||||||| ||||| || ||||||||| ||||||||| || |||||||| |
|
|
| T |
40258119 |
caagagctttattcatttcatcctcagaatattcgttgctactgccgtgctcagtatggtgcagggaagagagcccatcccaagaaatggagcttgattc |
40258218 |
T |
|
| Q |
101 |
aatgtccaacatttcagctttaccaagcctatcccacaaactaatttc |
148 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
40258219 |
aacatccaacatttcagctttaccaagcctctcccacaagctaatttc |
40258266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University