View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10291_high_16 (Length: 243)
Name: NF10291_high_16
Description: NF10291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10291_high_16 |
 | |
|
| [»] scaffold0018 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0018 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 174501 - 174343
Alignment:
| Q |
1 |
taacaagttttttctacaacaatgattccaagtatacattatatatcagtcctattcgacaattttt---acattattcataacattatatttacaatat |
97 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
174501 |
taacaagttttttctacaaca-tgattccaagtatacattatatatcagttctattcgacaatttttgttacattattcataacattatatttacaatat |
174403 |
T |
|
| Q |
98 |
gatgttatgtacgatttgtgatatgtatatataagatggctatcaaaattcttttcattt |
157 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
174402 |
gatgttatgtacgatttgggatatgtatacataagatggctatcaaaattcttttcattt |
174343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 84 - 145
Target Start/End: Complemental strand, 13560115 - 13560054
Alignment:
| Q |
84 |
tatatttacaatatgatgttatgtacgatttgtgatatgtatatataagatggctatcaaaa |
145 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||| |
|
|
| T |
13560115 |
tatatttacaatatgatgttatgtacgatccgtgatatgtatatataagatggttataaaaa |
13560054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 13560236 - 13560187
Alignment:
| Q |
18 |
aacaatgattccaagtatacattatatatcagtcctattcgacaattttt |
67 |
Q |
| |
|
|||||||||||||||||||||||||| |||| | ||||| |||||||||| |
|
|
| T |
13560236 |
aacaatgattccaagtatacattatacatcattgctatttgacaattttt |
13560187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University