View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10291_high_3 (Length: 410)
Name: NF10291_high_3
Description: NF10291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10291_high_3 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 171 - 410
Target Start/End: Original strand, 7452737 - 7452967
Alignment:
| Q |
171 |
gactagttacatgatataatttagggtcgtcgacaatgagctttgcacatatggtagcagtcatagaaacaaggtccaccacagtgaagaggacaatcca |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7452737 |
gactagttacatgatataatttagggtcgtcgacaatgagctttgcacatatggtagcagtcatagaaacaaggtccaccacagtgaagaggacaatcca |
7452836 |
T |
 |
| Q |
271 |
acctcatacctttgcaccttgttcttgtcatgcattgtgcaaattcccctaacctatactcttccttggatgcatgttcatgttgttgatgatgatgctt |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
7452837 |
acctcatacctttgcaccttgttcttgtcatgcattgtgcaaattcccctaacctatactcttccttagatgca---------tgttgatgatgatgctt |
7452927 |
T |
 |
| Q |
371 |
catgccctttatagttcctttcttccctttaacatgtgat |
410 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7452928 |
catgccccttatagttcctttcttccctttaacatgtgat |
7452967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 48 - 119
Target Start/End: Original strand, 7452614 - 7452685
Alignment:
| Q |
48 |
atgtcaattcaacatgcttgtctagttgtctacctaggaaaagcaagcaatgtaaaacactgattttgatcc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7452614 |
atgtcaattcaacatgcttgtctagttgtctacctaggaaaagcaagcaatgtaaaacactgattttgatcc |
7452685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 196 - 313
Target Start/End: Original strand, 52826916 - 52827033
Alignment:
| Q |
196 |
gtcgtcgacaatgagctttgcacatatggtagcagtcatagaaacaaggtccaccacagtgaagaggacaatccaacctcatacctttgcaccttgttct |
295 |
Q |
| |
|
|||| |||||||||||||| |||||||||| || |||||| |||| ||||||||||| |||||||| || ||||| ||||| || ||||| | ||| | |
|
|
| T |
52826916 |
gtcggcgacaatgagctttacacatatggtgacaatcatagtaacatggtccaccacaatgaagagggcagtccaatctcattcccttgcatcgagtttt |
52827015 |
T |
 |
| Q |
296 |
tgtcatgcattgtgcaaa |
313 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
52827016 |
tgtcatgcattgtgcaaa |
52827033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University