View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10291_low_12 (Length: 326)
Name: NF10291_low_12
Description: NF10291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10291_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 16 - 318
Target Start/End: Complemental strand, 7973430 - 7973128
Alignment:
| Q |
16 |
aaaaggacagtttgaaaacctattttgctgcaacccctgagtctccctaatttaatttgatcttggatcttgtgctatattattgtgtacagagaattca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7973430 |
aaaaggacagtttgaaaacctattttgctgcaacccctgagtctccctaatttaatttgatcttggatcttgtgctatattattgtgtacagagaattca |
7973331 |
T |
|
| Q |
116 |
gagtactgctttcaaattcagtcctcttcttgtgaatttatgtcttctcattttcattgtcagaataaccgtaagattttggtaacatttcttcactttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7973330 |
gagtactgctttcaaattcagtcctcttcttgtgaatttatgtcttctcattttcattgtcagaataaccgtaagattttggtaacatttcttcactttt |
7973231 |
T |
|
| Q |
216 |
tcacctattttttggatagatgcttccccttccacttcttcccttcacaaagatgctatcaaatagggtacaaagttgaagataaactacacacttgttc |
315 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7973230 |
tcaccttttttttggatagatgcttccccttccacttcttcccttcacaaagatgctatcaaatagggtacaaagttgaagataaactacacaattgttc |
7973131 |
T |
|
| Q |
316 |
tct |
318 |
Q |
| |
|
||| |
|
|
| T |
7973130 |
tct |
7973128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University