View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10291_low_18 (Length: 273)
Name: NF10291_low_18
Description: NF10291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10291_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 24 - 234
Target Start/End: Original strand, 46413212 - 46413426
Alignment:
| Q |
24 |
cctattactttcacatttttacacaactcttactccactatcttcccttcctttcttgtccaaccctgtctctttgccaaagaatttactctgctggaaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46413212 |
cctattactttcacatttttacacaactcttactccactgccatcccttcctttcttgtccaaccctgtctctttgccaaagaatttactctgctggaaa |
46413311 |
T |
 |
| Q |
124 |
ggcaagtaccacttgattacatcatctttttcgtctgacatggtcaactacttcaaatgcc----tccaaataatctgatcaggggaataactgaaaatt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46413312 |
ggcaagtaccacttgattacatcatctttttcgtctgacatggtcaactacttcaaatggctgtgtccaaataatctgatcaggggaataactgaaaatt |
46413411 |
T |
 |
| Q |
220 |
gattaggactttaaa |
234 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46413412 |
gattaggactttaaa |
46413426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University