View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10291_low_7 (Length: 378)
Name: NF10291_low_7
Description: NF10291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10291_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 17 - 363
Target Start/End: Complemental strand, 48008862 - 48008510
Alignment:
| Q |
17 |
aaaccaaatttctatctatccttgttgtaattgtaatagaggagatacttccaaaaacttgtccattttctgatatcctctttatg-gaccattgccaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48008862 |
aaaccaaatttctatctatccttgttgtaattgtaatagaggagatacttccaaaaacttgtccattttctgatatcctctttatgtgaccattgccaat |
48008763 |
T |
 |
| Q |
116 |
ttagtttggatgttcccaattcccttgacacaacttttgtgcacttgtgcagttgaaagctctatgccaaggaaataaatgtggtacacatgtctagtat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48008762 |
ttagtttggatgttcccaattcccttgacacaacttttgtgcacttgtgcagttgaaagctctatgccaaggaaataaatgtggtacacatgtctagtat |
48008663 |
T |
 |
| Q |
216 |
tag------nnnnnnnngttgagaaatgtctagtattagttgatcactgagcaactcattatgtcacaccaaaaactggatcgagatatgctgcaacagc |
309 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48008662 |
tagtttttttttttttttttgagaaatgtctagtattagttgatcactgagcaactcattatgtcacaccaaaaactggatccagatatgctgcaacagc |
48008563 |
T |
 |
| Q |
310 |
acgtagttttatgttgtaaaatgatttcagccgttaatttgaggttaaatgttt |
363 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48008562 |
acgtagttttatgttct-aaatgatttcagccgttaatttgaggttaaatgttt |
48008510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University