View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10292_low_11 (Length: 257)
Name: NF10292_low_11
Description: NF10292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10292_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 19290950 - 19291185
Alignment:
| Q |
1 |
atcaagatgtgcgcattttgagacttatgcggggaaaa-aacgtaaaggaccaattcagaagaaaaagatcaatttaaaggaccggatgtgcaattttac |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19290950 |
atcaagatgtgcgcattttgagacttatgcggggaaaaaaacgtaaaagaccaattcagaagaaaaagatcaatttaaaggaccggatgtgcaattttac |
19291049 |
T |
|
| Q |
100 |
attttttgttctcctggcttatttttcattcatgaaggatttgcaatgttccactttctcaagttgctttaatttgattttctttgattgttttgaaacg |
199 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19291050 |
attttttgttctcctgtcttatttttcattcatgaaggatctgcaatgttccactttctcaagttgctttaa----------tttgattgttttgaaacg |
19291139 |
T |
|
| Q |
200 |
ctgagatcaattgattttctcaaagattttgtttcttcatcacagg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19291140 |
ctgagatcaattgattttctcaaagattttgtttcttcatcacagg |
19291185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University