View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10292_low_8 (Length: 273)
Name: NF10292_low_8
Description: NF10292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10292_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 141 - 259
Target Start/End: Original strand, 2260169 - 2260287
Alignment:
| Q |
141 |
cgtgaatttattcaggatggagagagagtttatggactataagaaactggggattgatttgaatcagtttatgggaagcagctcaagcattggtgcaaaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2260169 |
cgtgaatttattcaggatggagagagagtttatggactataagaaactggggattgatttgaatcagtttatgggaagcagctcaagcattggtgcaaaa |
2260268 |
T |
|
| Q |
241 |
agagtgactaatgtctgtg |
259 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2260269 |
agagtgactaatgtctgtg |
2260287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 18 - 79
Target Start/End: Original strand, 2260046 - 2260107
Alignment:
| Q |
18 |
ctcaggaatctaagagcattgctgtaataatcattcaatctcttattaatttcctaattaag |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2260046 |
ctcaggaatctaagagcattgctgtaataatcattcaatctcttattaatttcctaattaag |
2260107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 197 - 248
Target Start/End: Complemental strand, 44733831 - 44733780
Alignment:
| Q |
197 |
atttgaatcagtttatgggaagcagctcaagcattggtgcaaaaagagtgac |
248 |
Q |
| |
|
|||||||||| || || || |||||||||||||||||||| ||||||||||| |
|
|
| T |
44733831 |
atttgaatcaattcattggtagcagctcaagcattggtgctaaaagagtgac |
44733780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University