View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10294_high_7 (Length: 219)
Name: NF10294_high_7
Description: NF10294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10294_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 43 - 205
Target Start/End: Original strand, 40256290 - 40256452
Alignment:
| Q |
43 |
gatgagaaagttccaccgcatgagtttcttgctagaacaagaatggcttcattctctgttcatgaaggtgttggtagaactttgaaaggacgtgatctta |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40256290 |
gatgagaaaattccaccgcatgagtttcttgctagaacaagaatggcttcattctctgttcatgaaggtgttggtagaactttgaaaggacgtgatctta |
40256389 |
T |
 |
| Q |
143 |
gtagggttcgaaatgcgatttgggctaaaactggttttcaagactagatcgaacatttttatt |
205 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40256390 |
gtagggttcgaaatgcaatttgggctaaaactggttttcaagactagatcgaacatttttatt |
40256452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 79 - 176
Target Start/End: Complemental strand, 21778750 - 21778653
Alignment:
| Q |
79 |
acaagaatggcttcattctctgttcatgaaggtgttggtagaactttgaaaggacgtgatcttagtagggttcgaaatgcgatttgggctaaaactgg |
176 |
Q |
| |
|
|||||| ||||||| |||||||| || ||||||||||| || ||| | || ||| | |||||||| ||| || ||||||| || ||||| |||||||| |
|
|
| T |
21778750 |
acaagagtggcttctttctctgtacacgaaggtgttggaaggactctcaagggaagagatcttagcaggcttagaaatgcaatatgggcaaaaactgg |
21778653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University