View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10294_low_8 (Length: 229)
Name: NF10294_low_8
Description: NF10294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10294_low_8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 6 - 229
Target Start/End: Complemental strand, 35710609 - 35710385
Alignment:
| Q |
6 |
accagctgctgatgatgtttcaatcattgaacagtttatgtctaagcataatcttaaggtagttttgtgatataatgagttgannnnnnnnn--gtatgt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
35710609 |
accagctgctgatgatgtttcaatcattgaacagtttatgtctaagcataatctta-ggtagttttgtgatataatgagttgatttttttttttgtatgt |
35710511 |
T |
|
| Q |
104 |
attaattcatcaatttatttgtcataaactgttcaggttggaaacgaaattgatgaagttgattacacaaattctgataataatgtttctgcaagtacta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35710510 |
attaattcatcaatttatttgtcataaactgttcaggttggaaacgaaattgatgaagttgattacacaaattctgataataatgtttctgcgagtacta |
35710411 |
T |
|
| Q |
204 |
ataaataggttggaacaaaacctatc |
229 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
35710410 |
ataaataggttggaacaaaacctatc |
35710385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University