View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10295_high_1 (Length: 478)
Name: NF10295_high_1
Description: NF10295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10295_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 244 - 465
Target Start/End: Original strand, 39772075 - 39772296
Alignment:
| Q |
244 |
catcagaacacaatctcatacggtcgcctttatcacaattgatagatttgggaacattgggaatcgaaacacggccaggaagctcaacagtacgaaggtt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39772075 |
catcagaacacaatctcatacggtcgcctttatcacaattgatagatttgggaacattgggaatcgaaacacggccaggaagctcaacagtacgaaggtt |
39772174 |
T |
 |
| Q |
344 |
gtcgtggtcaatagcaatcaatttagaatcatatttacagaatttgagtcttagatcgttggtgagatcgtaacctaatccaacggatttaatcacatct |
443 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39772175 |
gtcgtggtcaatagcaatcaatttggaatcatatttgcagaatttgagtcttagatcgttggtgagatcgtaacctaatccaacggatttaatcacatct |
39772274 |
T |
 |
| Q |
444 |
tcaacagacaacaccttcttct |
465 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39772275 |
tcaacagacaacaccttcttct |
39772296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 116; E-Value: 8e-59
Query Start/End: Original strand, 40 - 163
Target Start/End: Original strand, 39771856 - 39771979
Alignment:
| Q |
40 |
acatgggaaactaaattggtattaactctaaaattggcaagttaaattaaaaatttctagaatccaacagagaaaaacacaacaatttagttacctagac |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39771856 |
acatgggaaactaaattggtattaactctaaaattggtaagttaaattaaaaatttctagaatccaacagagaaaaacacaacaatttagttaccaagac |
39771955 |
T |
 |
| Q |
140 |
ccacataataaacttgagctaaaa |
163 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
39771956 |
ccacataataaacttgagctaaaa |
39771979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University