View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10295_high_6 (Length: 233)
Name: NF10295_high_6
Description: NF10295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10295_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 17 - 219
Target Start/End: Original strand, 12519631 - 12519833
Alignment:
| Q |
17 |
agcatcaaggagaatattttgtatgggaaagatgatgctactcttgaagaactaaaacgtgctgtaaagctttcggatgctcaatctttcatcaacaacc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12519631 |
agcatcaaggagaatattttgtatgggaaagatgatgctactcttgaagaactaaaacgtgctgtaaagctttcggatgctcaatctttcatcaacaacc |
12519730 |
T |
 |
| Q |
117 |
ttcccgaaagattagacactcaggtaaagctatttgatctatgcatgtttagtttgttattatcaaacatgtcttaattgcgcaattaatctatgcacct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12519731 |
ttcccgaaagattagacactcaggtaaagctatttgatctatgcatgtttagtttgttattatcaaacatgtcttaattgcgcaattaatctatgcacct |
12519830 |
T |
 |
| Q |
217 |
ttg |
219 |
Q |
| |
|
||| |
|
|
| T |
12519831 |
ttg |
12519833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 25 - 143
Target Start/End: Original strand, 27722680 - 27722798
Alignment:
| Q |
25 |
ggagaatattttgtatgggaaagatgatgctactcttgaagaactaaaacgtgctgtaaagctttcggatgctcaatctttcatcaacaaccttcccgaa |
124 |
Q |
| |
|
|||||| || |||||||| ||| |||| || |||| |||||||||||| |||||| | | ||||| ||||||| |||||||||||||| ||||| || |
|
|
| T |
27722680 |
ggagaacatattgtatggtaaaaatgacgccactcctgaagaactaaaccgtgctttggaactttctgatgctctttctttcatcaacaatcttcctgat |
27722779 |
T |
 |
| Q |
125 |
agattagacactcaggtaa |
143 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
27722780 |
ggattagatactcaggtaa |
27722798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University