View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10295_low_10 (Length: 220)
Name: NF10295_low_10
Description: NF10295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10295_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 58 - 202
Target Start/End: Original strand, 28939228 - 28939372
Alignment:
| Q |
58 |
gttgaggcctaagaagttactaggattattatttgtataaattttatggagaaattcaagtacatgttcatataaaaaatcatcgaactgaatcctccac |
157 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28939228 |
gttgaggcctgagaagttactaggattattatttgtataaattttatggagaaattcaagtacatgttcatataaaaaatcatcgaactgaatcctccat |
28939327 |
T |
|
| Q |
158 |
aatcaccactatggtgcacccgactatatactgttagattaaaag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28939328 |
aatcaccactatggtgcacccgactatagactgttagattaaaag |
28939372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 28939174 - 28939203
Alignment:
| Q |
1 |
cttagtgcatgagggttaaatacacatgca |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28939174 |
cttagtgcatgagggttaaatacacatgca |
28939203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University