View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10295_low_4 (Length: 283)
Name: NF10295_low_4
Description: NF10295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10295_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 15 - 276
Target Start/End: Original strand, 52766537 - 52766798
Alignment:
| Q |
15 |
aattaggatgttggggttggaaaaattgtgtaccagctgccatgaaagcattaagcggagctgagtaaagtgaaggatcgaaatggataccgctggttgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52766537 |
aattaggatgttggggttggaaaaattgtgtaccagctgccatgaaagcattaagcggagctgagtaaagtgaagggtcgaaatggataccgctggttgt |
52766636 |
T |
 |
| Q |
115 |
agctgtagttgctgttgcagccatgaaatcaagttgttgaggttgatgatgacctccaccagaagaaccttcaataggtgcaatactggtgtaaagattt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52766637 |
agctgtagttgctgttgcagccatgaaatcaagttgttgaggttgatgatgacctccaccagaagaaccttcaataggtgcaatactggtgtaaagattt |
52766736 |
T |
 |
| Q |
215 |
ggaggaccttgatcatagagaattcctttgaaaacatgccctcctatgttcacagccctttg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52766737 |
ggaggaccttgatcatagagaattcctttgaaaacatgccctcctatgttcacagccgtttg |
52766798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University