View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10296_high_9 (Length: 249)
Name: NF10296_high_9
Description: NF10296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10296_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 29279684 - 29279921
Alignment:
| Q |
1 |
gtgatgtgagtttgcaagaagttgatggtgaaaagtatatggatannnnnnnnnnnnnnnnnnnaggtggtggtttgttttttatgggaagtgagaatct |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29279684 |
gtgatgtgaatttgcaagaagttgatggtgaaaagtatatggataatgatgatgatgatgatgaaggtggtggtttgttttttatgggaagtgagaatct |
29279783 |
T |
|
| Q |
101 |
tcaatgggcacaaggtagagctggtgaagatcgtttacatattgtaatatcagagaaacataaatgggtttttgttggaatttatgatggttttaacggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29279784 |
tcaatgggcacaaggtagagctggtgaagatcgtttacatattgtaatatcagagaaatataaatgggtttttgttggaatttatgatggttttaacggt |
29279883 |
T |
|
| Q |
201 |
ccagatgctactgattatcttcttgaaaatctcttctt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29279884 |
ccagatgctactgattatcttcttgaaaatctcttctt |
29279921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 85 - 218
Target Start/End: Complemental strand, 23798800 - 23798667
Alignment:
| Q |
85 |
tgggaagtgagaatcttcaatgggcacaaggtagagctggtgaagatcgtttacatattgtaatatcagagaaacataaatgggtttttgttggaattta |
184 |
Q |
| |
|
|||||||| |||||||||||||||| ||||| | ||| || ||||||||| | ||| |||| | || ||| ||||| |||||||||||||| ||||| |
|
|
| T |
23798800 |
tgggaagtcagaatcttcaatgggctcaagggaaagcaggggaagatcgtgttcatgttgttgtttctgaggaacatggttgggtttttgttgggattta |
23798701 |
T |
|
| Q |
185 |
tgatggttttaacggtccagatgctactgattat |
218 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||| |
|
|
| T |
23798700 |
tgatggttttaatggtcctgatgcacctgattat |
23798667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 224
Target Start/End: Complemental strand, 21970421 - 21970320
Alignment:
| Q |
123 |
ggtgaagatcgtttacatattgtaatatcagagaaacataaatgggtttttgttggaatttatgatggttttaacggtccagatgctactgattatcttc |
222 |
Q |
| |
|
|||||||||||| | |||||||| |||| || | ||| |||||||| ||| |||||||||||||| ||||| ||||| ||||| ||||||||||||| |
|
|
| T |
21970421 |
ggtgaagatcgtatgcatattgtgatatgcgaagatcatggatgggtttatgtcggaatttatgatggatttaatggtcctgatgcaactgattatcttc |
21970322 |
T |
|
| Q |
223 |
tt |
224 |
Q |
| |
|
|| |
|
|
| T |
21970321 |
tt |
21970320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University