View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10296_low_11 (Length: 250)
Name: NF10296_low_11
Description: NF10296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10296_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 146 - 240
Target Start/End: Original strand, 43616933 - 43617027
Alignment:
| Q |
146 |
ttaaaaagaagactgctttccggctcactgatagtaatttgtatagcagattggtgcttagagcaaactaaaaatgtctaaaatcaaaaataaat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43616933 |
ttaaaaagaagactgctttccggctcactaatggtaatttgtatagcagattggtacttagagcaaactaaaaatgtctaaaatcaaaaataaat |
43617027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 198 - 240
Target Start/End: Complemental strand, 275697 - 275655
Alignment:
| Q |
198 |
ggtgcttagagcaaactaaaaatgtctaaaatcaaaaataaat |
240 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
275697 |
ggtgcttagagcaaactaaaaatggctaaaatcaaaaataaat |
275655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 57 - 139
Target Start/End: Complemental strand, 275828 - 275739
Alignment:
| Q |
57 |
gtttttcatgaacttgcaa----atatctacaccatccgtagaaattagaataccaagaggaattggacca---ttcctcaagcgtgaag |
139 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||| ||||| |||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
275828 |
gttttccatgaacttgcaacacaatatctacaccatccggagaaaccagaataccaagaggaattggaccagagttcctcgagcgtgaag |
275739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University