View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10296_low_12 (Length: 249)

Name: NF10296_low_12
Description: NF10296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10296_low_12
NF10296_low_12
[»] chr4 (2 HSPs)
chr4 (1-238)||(29279684-29279921)
chr4 (85-218)||(23798667-23798800)
[»] chr7 (1 HSPs)
chr7 (123-224)||(21970320-21970421)


Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 29279684 - 29279921
Alignment:
1 gtgatgtgagtttgcaagaagttgatggtgaaaagtatatggatannnnnnnnnnnnnnnnnnnaggtggtggtttgttttttatgggaagtgagaatct 100  Q
    ||||||||| |||||||||||||||||||||||||||||||||||                   ||||||||||||||||||||||||||||||||||||    
29279684 gtgatgtgaatttgcaagaagttgatggtgaaaagtatatggataatgatgatgatgatgatgaaggtggtggtttgttttttatgggaagtgagaatct 29279783  T
101 tcaatgggcacaaggtagagctggtgaagatcgtttacatattgtaatatcagagaaacataaatgggtttttgttggaatttatgatggttttaacggt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
29279784 tcaatgggcacaaggtagagctggtgaagatcgtttacatattgtaatatcagagaaatataaatgggtttttgttggaatttatgatggttttaacggt 29279883  T
201 ccagatgctactgattatcttcttgaaaatctcttctt 238  Q
    ||||||||||||||||||||||||||||||||||||||    
29279884 ccagatgctactgattatcttcttgaaaatctcttctt 29279921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 85 - 218
Target Start/End: Complemental strand, 23798800 - 23798667
Alignment:
85 tgggaagtgagaatcttcaatgggcacaaggtagagctggtgaagatcgtttacatattgtaatatcagagaaacataaatgggtttttgttggaattta 184  Q
    |||||||| |||||||||||||||| ||||| | ||| || ||||||||| | ||| ||||  | || ||| |||||   |||||||||||||| |||||    
23798800 tgggaagtcagaatcttcaatgggctcaagggaaagcaggggaagatcgtgttcatgttgttgtttctgaggaacatggttgggtttttgttgggattta 23798701  T
185 tgatggttttaacggtccagatgctactgattat 218  Q
    |||||||||||| ||||| |||||  ||||||||    
23798700 tgatggttttaatggtcctgatgcacctgattat 23798667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 224
Target Start/End: Complemental strand, 21970421 - 21970320
Alignment:
123 ggtgaagatcgtttacatattgtaatatcagagaaacataaatgggtttttgttggaatttatgatggttttaacggtccagatgctactgattatcttc 222  Q
    |||||||||||| | |||||||| ||||  ||  | |||  |||||||| ||| |||||||||||||| ||||| ||||| ||||| |||||||||||||    
21970421 ggtgaagatcgtatgcatattgtgatatgcgaagatcatggatgggtttatgtcggaatttatgatggatttaatggtcctgatgcaactgattatcttc 21970322  T
223 tt 224  Q
    ||    
21970321 tt 21970320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University