View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10297_high_5 (Length: 335)

Name: NF10297_high_5
Description: NF10297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10297_high_5
NF10297_high_5
[»] chr2 (1 HSPs)
chr2 (17-55)||(33570655-33570693)
[»] chr6 (1 HSPs)
chr6 (27-77)||(15566775-15566825)
[»] chr3 (1 HSPs)
chr3 (33-77)||(1730655-1730698)


Alignment Details
Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 33570655 - 33570693
Alignment:
17 caaactagggtttttctatgaatttagggttgagaaaat 55  Q
    |||||||||||||||||||||||||||||||||||||||    
33570655 caaactagggtttttctatgaatttagggttgagaaaat 33570693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 27 - 77
Target Start/End: Original strand, 15566775 - 15566825
Alignment:
27 tttttctatgaatttagggttgagaaaattcagagaatttagagaagaaga 77  Q
    ||||| |||||||||||||||| |||||||  ||||| |||||||||||||    
15566775 tttttttatgaatttagggttgtgaaaattgggagaaattagagaagaaga 15566825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 33 - 77
Target Start/End: Original strand, 1730655 - 1730698
Alignment:
33 tatgaatttagggttgagaaaattcagagaatttagagaagaaga 77  Q
    ||||||||||||||||| ||| || ||||||||||||||||||||    
1730655 tatgaatttagggttgacaaa-ttgagagaatttagagaagaaga 1730698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University