View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10297_high_5 (Length: 335)
Name: NF10297_high_5
Description: NF10297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10297_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 33570655 - 33570693
Alignment:
| Q |
17 |
caaactagggtttttctatgaatttagggttgagaaaat |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33570655 |
caaactagggtttttctatgaatttagggttgagaaaat |
33570693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 27 - 77
Target Start/End: Original strand, 15566775 - 15566825
Alignment:
| Q |
27 |
tttttctatgaatttagggttgagaaaattcagagaatttagagaagaaga |
77 |
Q |
| |
|
||||| |||||||||||||||| ||||||| ||||| ||||||||||||| |
|
|
| T |
15566775 |
tttttttatgaatttagggttgtgaaaattgggagaaattagagaagaaga |
15566825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 33 - 77
Target Start/End: Original strand, 1730655 - 1730698
Alignment:
| Q |
33 |
tatgaatttagggttgagaaaattcagagaatttagagaagaaga |
77 |
Q |
| |
|
||||||||||||||||| ||| || |||||||||||||||||||| |
|
|
| T |
1730655 |
tatgaatttagggttgacaaa-ttgagagaatttagagaagaaga |
1730698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University