View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10297_low_10 (Length: 226)
Name: NF10297_low_10
Description: NF10297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10297_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 38 - 211
Target Start/End: Original strand, 25814459 - 25814630
Alignment:
| Q |
38 |
tttaaaatcaaatcaaattttaaataagttttgtctacaaatacatgtacccaacaaaatttcagggtgcgtaagaatttatttgtttctaaaccttgtg |
137 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25814459 |
tttaaaatcaaatcaaattttaaa--agttttgtctacaaatacatgtacccaacaaaatttcagggtgcgtaagaatttatttgtttctaaaccttgtg |
25814556 |
T |
|
| Q |
138 |
tcgcctacctttttacttgttgaaattctttctcaagaaagccaatgaatctcacttgcactagcccttcttct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25814557 |
tcgcctacctttttacttgttgaaattctttctcaagaaagccaatgaatctcacttgcactagcccttcttct |
25814630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 72
Target Start/End: Complemental strand, 28957999 - 28957949
Alignment:
| Q |
23 |
ttttgtattaatttattt-aaaatcaaatcaaattttaaataagttttgtc |
72 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||| | ||||||| |
|
|
| T |
28957999 |
ttttgtattaatttatttaaaaatcaaatcaaattctaaatgaattttgtc |
28957949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University