View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10297_low_4 (Length: 393)
Name: NF10297_low_4
Description: NF10297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10297_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 10 - 252
Target Start/End: Original strand, 48565207 - 48565444
Alignment:
| Q |
10 |
agtagcataggaaagcaaatgcataccgattcacttggtagtttaataaaattattttttgttagttcatattgatttacattatcttgcggtgcaaact |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48565207 |
agtatcataggaaagcaaatgcataccgattcacttggtagtttaataaaattattttttgttagttcatattgatttacattatcttgcggtgcaaact |
48565306 |
T |
|
| Q |
110 |
tataaaaactaaacatttgatgacttctgcatgctaactaacataagtctttttcatttaatctgagttatttaaataccgctagtgaatttccgagatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48565307 |
tataaaaactaaacatttgatgacttctacatgctaactaacataagtc-ttttcatttaatctgag----ttaaataccgctagtgaatttccgagatt |
48565401 |
T |
|
| Q |
210 |
tctacagtctagtctaaccatgatgaccaaaggcttattctat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48565402 |
tctacagtctagtctaaccatgatgaccaaaggcttattctat |
48565444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 264 - 324
Target Start/End: Original strand, 48565488 - 48565548
Alignment:
| Q |
264 |
tgagggatgggaaattgaatcatcatatttgaagtgtgtgcaatctccctcttttttctct |
324 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48565488 |
tgaggtatgggaaattgaatcatcatatttgaagtgtgtgcaatctccctcttttttctct |
48565548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University